| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
This mutant contains a deletion from bp24 to 36 of the wildtype socs2 coding sequence, CACGGAAAGCATC, is deleted. The mutated socs2 codes for a protein containing 31 aa, in which only the sequence of the first 8 aa is identical to wildtype socs2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ92 |
|
|
his mutant contains a deletion from bp221 to 281 of the wildtype socs3a coding sequence, CGGCCTGTTTGACGCTAGCATGCGGCTGCCGTTTTACCACTTCAAGACCTTCAGCTCCAAG, is deleted. The mutated socs3a codes for a protein containing 44 aa, in which only the sequence of the first 12 aa is identical to wildtype socs3a. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ93 |
|
|
Between the 313 bp and 315 bp of the wildtype socs1a coding sequence, a cytosine(C), is deleted. The mutated socs1a codes for a protein containing 63 aa, in which only the sequence of the first 22 aa is identical to wildtype socs1a. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ94 |
|
|
This mutant contains a deletion from bp31 to 41 of the wildtype socs2 coding sequence, AGCATCGAGAA, is deleted. The mutated socs2 codes for a protein containing 10 aa, and the sequence of the 10 aa is identical to wildtype socs2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ95 |
|
|
This mutant contains a deletion from bp456 to 465 of the wildtype socs3b coding sequence, CAAACTGCAG, is deleted. The mutated socs3b codes for a protein containing 52 aa, in which only the sequence of the first 44 aa is identical to wildtype socs3b. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ97 |
|
|
macrophage-specific GFP |
CZ98 |
|
|
|
CZ102 |
|
|
sustainably expressed from hepatoblasts and liver progenitor cells in liver primordium to hepatocyte |
CZ103 |
|
|
|
CZ104 |
|
|
|
CZ105 |
