| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
Three nucleotides, CAG, located in the splice acceptor site of intron 4, are deleted. Plus the adjacent twenty-nine-nucleotide coding sequence, AGCCACCATAACATCTCTGGAGGACTTTG, is mutated into GAGGCTGAGCAGAGGCTGA. This mutation may lead to mis-splicing of the ndel1a transcript, resulting in the use of an alternative acceptor site (changing the 5’ boundary of the downstream exon 5) or simply the retention of the intron 4. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ217 |
|
|
390 bp to 396 bp of the wild-type ndel1a coding sequence, AGCCACC, is deleted. The mutated ndel1a codes for a truncated protein containing 130 aa, 129 aa of which are identical to wildtype ndel1a.Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ218 |
|
|
The zju5Tg allele is a transgenic zebrafish line Tg(d113p53:EGFP) with green fluorescent protein driven by 4.1 kb upstream of the d113p53 translational start drives EGFP expressionstrongly upregulated by DNA damage signals. |
CZ219 |
|
|
mitochondrial morphology.a platform for research on apoptosis and mitochondrial physiology and ascreen for apoptosis-modulating drugs. It could also facilitate study of the pathogenesis ofapoptosis-related diseases. |
CZ222 |
|
|
|
CZ223 |
|
|
2.5 kb upstream of the Cyp26a1 translational start drives EYFP expression. |
CZ224 |
|
|
|
CZ227 |
|
|
|
CZ233 |
|
|
beta-actin drives zCas9 expression in whole embryo |
CZ234 |
|
|
If you need this line, please email to CZRC to obtain a further MTA. Thank you! |
CZ239 |
