| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
Between 272 bp to 291 bp of the wild-type net1 coding sequence, GCCAGACCCTCCAGGCCTCA, is deleted; and C, is inserted. |
CZ287 |
|
|
Between 695 bp to 702 bp of the wild-type fscn1a coding sequence, GTCCAGTC, is mutated to C. |
CZ288 |
|
|
Between 226 bp to 234 bp of the wild-type cyp17a1 coding sequence, TGTATT, is deleted. The mutated cyp17a1 codes for a truncated protein containing 234 aa, of which 519 aa are identical to wildtype cyp17a1 |
CZ292 |
|
|
In the 149 bp of the wild-type ppp2r3a coding sequence, G, is mutated into TGCTACAGTTGC in exon 1. The mutated ppp2r3a codes for a truncated protein containing 897 aa, of which 1161 aa are identical to wildtype ppp2r3a. |
CZ293 |
|
|
Between 161bp and 170bp of the wild-type nr5a2 coding sequence, 10bp is deleted and 6bp is inserted in exon 2 . The mutated nr5a2 codes for a truncated protein containing 59 aa, of which 517 aa are identical to wildtype nr5a2. |
CZ294 |
|
|
Between 32bp to 37bp of the wild-type mstnb coding sequence, 6bp is deleted and 26bp is inserted.The mutated mstnb codes for a truncated protein containing 60 aa, of which 1125 aa are identical to wildtype mstnb. |
CZ295 |
|
|
Between 286 bp to 304 bp of the wild-type sstr1b coding sequence, ACTTCAGCCGCAGTGCACC, is deleted. The mutated sstr1b codes for a truncated protein containing 121 aa, 95 aa of which is identical to wildtype sstr1b. |
CZ296 |
|
|
298bp of the wild-type sstr1b coding sequence, G, is mutated into cattactatttgtttagtaa. The mutated sstr1b codes for a truncated protein containing 125 aa, 99 aa of which is identical to wildtype sstr1b. |
CZ297 |
|
|
Between 202bp and 208 bp of the wild-type igf2a coding sequence, ACAGA is deleted in exon 3. The mutated igf2a codes for a truncated protein containing 86 aa, of which 197 aa are identical to wildtype igf2a. |
CZ298 |
|
|
Between 121bp and 138 bp of the wild-type igf2a coding sequence, 16bp is deleted in exon 2. The mutated igf2a codes for a truncated protein containing 43 aa, of which 197 aa are identical to wildtype igf2a |
CZ299 |
