| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
Between 216 bp to 217 bp of the wild-type csrp3 coding sequence, G is inserted in exon 3. |
CZ451 |
|
|
Between 211 bp to 217 bp of the wild-type csrp3 coding sequence, TATGGGT is deleted in exon 3. |
CZ452 |
|
|
Between 297 bp to 305 bp of the wild-type msx3 coding sequence, AGTGGAGAG is mutated to TATCTGCGTAAAGCGACACACTACA in exon 1. |
CZ453 |
|
|
Between 217 bp to 222 bp of the wild-type nfe2l2a coding sequence, CTGCAG is mutated to GAGGA in exon 2. |
CZ454 |
|
|
Between 580 bp to 581 bp of the wild-type esr1 coding sequence, TG is mutated to CGAC in exon 4 |
CZ455 |
|
|
Between 655 bp to 661 bp of the wild-type klf2b coding sequence, GCGTATC is mutated to TGA in exon 2. |
CZ456 |
|
|
Between 737 bp to 738 bp of the wild-type klf2b coding sequence, TG is mutated to ACC in exon 2. |
CZ457 |
|
|
Between 918 bp to 922 bp of the wild-type lepr coding sequence, CCGCA is mutated to GCA in exon 8. |
CZ458 |
|
|
Between 169 bp to 176 bp of the wild-type fndc5b coding sequence, GTCATTGG is deleted in exon 2. |
CZ460 |
|
|
Between 169 bp to 170 bp of the wild-type fndc5b coding sequence, GT is mutated to TCCAGGAAAC in exon 2. |
CZ461 |
